Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig1892_1042675

[Submit comment/correction]

Sequence	wsnp_RFL_Contig1892_1042675
Contig	2DL_9910080
Probe	wsnp_RFL_Contig1892_1042675
DNA Homology	2DL_9910080 Best IWGSC match 130 2e-28 URGI_Best IWGSC_N
BLAST, e-value	2e-28 2DL_9910080 Best IWGSC match
DNA	ctaccaggtggacggaaacaaRgagatgatggccatcgggttgatgaaca ttgtcggctcatgtacatcgtg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.