Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c3762_715

[Submit comment/correction]

Sequence	Excalibur_c3762_715
Contig	2BL_2190218
Probe	Excalibur_c3762_715
DNA Homology	2BL_2190218 Best IWGSC match 130 4e-28 URGI_Best IWGSC_N
BLAST, e-value	4e-28 2BL_2190218 Best IWGSC match
DNA	cttttttgcttgctttgtttcgccctatttttgttgttgctcgcagaagc Rcggattgccatgcaacgcctgtagtggcacaagcctctgaatcaaagaa a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.