Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ku_c5710_312

[Submit comment/correction]

Sequence	Ku_c5710_312
Contig	2AL_4756016
Probe	Ku_c5710_312
DNA Homology	2AL_4756016 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 2AL_4756016 Best IWGSC match
DNA	tgtgagggattggctgtacagggcggagaggctcgcggccaatgagtgca Rtgatgctgcaatgatgctggaaagaatcgtgcatcaagaggtggaagga g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.