Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c3644_491

[Submit comment/correction]

Sequence	BobWhite_c3644_491
Contig	2AS_4426651
Probe	BobWhite_c3644_491
DNA Homology	2AS_4426651 Best IWGSC match 161 1e-37 URGI_Best IWGSC_N
BLAST, e-value	1e-37 2AS_4426651 Best IWGSC match
DNA	aggagggacggcgacggaccggccggcctcatgaggacgccatgtaatcg Mttgggtcggcgatggacacctcctcgaactcgttgtcttttctcaatgc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.