Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ex_c23985_1460

[Submit comment/correction]

Sequence	Ex_c23985_1460
Contig	2AS_5294391
Probe	Ex_c23985_1460
DNA Homology	2AS_5294391 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 2AS_5294391 Best IWGSC match
DNA	gctggatgaagagtctacgttcccaaaggcaacagatctttcctttgcta Rcaaacttaagcagcatttgagtggaaaccctggatttaagggcgaacaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.