Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c8085_498

[Submit comment/correction]

Sequence	BobWhite_c8085_498
Contig	2DS_5352598
Probe	BobWhite_c8085_498
DNA Homology	2DS_5352598 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 2DS_5352598 Best IWGSC match
DNA	gttgtcccagcaaccgtccttcccaaccatggcagcatgaatacaactct Rccatctttggtcttggggacaattaaacccatcccttcaggtgaataat a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.