GrainGenes Sequence Report: 1AL_3936654
Sequence
BobWhite_rep_c63205_143
Contig
1AL_3936654
Probe
BobWhite_rep_c63205_143
DNA Homology
1AL_3936654 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value
4e-33 1AL_3936654 Best IWGSC match
DNA
ctgttggcattgccgcatagcccttccaagatgttccttactttcttctc
Rctctttgtagatggtgctaggacaacagacaggaaccgtgcaggcagac
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3936654
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
