Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_rep_c63205_215

[Submit comment/correction]

Sequence	BobWhite_rep_c63205_215
Contig	1AL_3889901
Probe	BobWhite_rep_c63205_215
DNA Homology	1AL_3889901 Best IWGSC match 135 9e-30 URGI_Best IWGSC_N
BLAST, e-value	9e-30 1AL_3889901 Best IWGSC match
DNA	taagggtgggactctgtctcgcctcccaggccagcagccatgcccacgtc Rtcttcggatctccagtagctgctgttggcattgccgcatagcccttcca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.