Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c32848_578

[Submit comment/correction]

Sequence	RAC875_c32848_578
Contig	1AL_3977305
Probe	RAC875_c32848_578
DNA Homology	1AL_3977305 Best IWGSC match 104 2e-20 URGI_Best IWGSC_N
BLAST, e-value	2e-20 1AL_3977305 Best IWGSC match
DNA	tgttttcacatccctatggatgaggggtggattgcagcccttgtgtagat Rctcaagcccttgtgcggattcctgtgcaatacaaagtctctgtgcccag g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.