Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AL_3921954

[Submit comment/correction]

Sequence	RFL_Contig577_764
Contig	1AL_3921954
Probe	RFL_Contig577_764
DNA Homology	1AL_3921954 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 1AL_3921954 Best IWGSC match
DNA	gtcaaggtccgcgacatgatgaaggagctcactgacctgctcggcacgat Mgccgtgagcgacgtttttccgagactagggtggctggtggactgggcga c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.