Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig3469_3608001

[Submit comment/correction]

Sequence	wsnp_RFL_Contig3469_3608001
Contig	1AL_3976073
Probe	wsnp_RFL_Contig3469_3608001
DNA Homology	1AL_3976073 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 1AL_3976073 Best IWGSC match
DNA	tgatatttactaaaaagaaccacagagcaaccacaaccatgttccaaagc Mgatcaggcgtcttccgtcttgcacaggtccagcagtgacagtgtctctg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.