Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0043a23_530

[Submit comment/correction]

Sequence	tplb0043a23_530
Contig	1BL_3796575
Probe	tplb0043a23_530
DNA Homology	1BL_3796575 Best IWGSC match 128 1e-27 URGI_Best IWGSC_N
BLAST, e-value	1e-27 1BL_3796575 Best IWGSC match
DNA	cggcgagaatgcccgccttcctccctccagacggccttcttctacgtctc Rctctacctggtggccatcgcgcagagcggccacaagccctgcgtgcagg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.