Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_rep_c69266_68192766

[Submit comment/correction]

Sequence	wsnp_Ex_rep_c69266_68192766
Contig	5BL_8934487
Probe	wsnp_Ex_rep_c69266_68192766
DNA Homology	5BL_8934487 Best IWGSC match 211 0 URGI_Best IWGSC_N
BLAST, e-value	0 5BL_8934487 Best IWGSC match
DNA	tcttcctcgagaactcatcgatcgggagaccttgaacaattgtccattca ccaccactgcacgttactgggaaggagtagataagaccagcaggcacacc Rtatgaaccatcagagtacacacccatggaaacaaatgttccctcagggg ttcccagaacccagtcacggatgtgatcacaagctgagctggcagcagag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.