GrainGenes Sequence Report: 1AL_3971476
Sequence
Excalibur_c48282_143
Contig
2AS_5308402 1AL_3971476
Species
Triticum aestivum
Probe
Excalibur_c48282_143
DNA Homology
2AS_5308402 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value
2.94273e-44 2AS_5308402 Best IWGSC match
DNA
agtcatcacattgctcaacccaatcagatctcgagaatcttggaggagct
Rgcaagaatcaaggagaaacatcagctgatggtgagaatcttggaggaga
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3971476
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
