Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX5970

[Submit comment/correction]

Sequence	IACX5970
Contig	1DS_1908596
Probe	IACX5970
DNA Homology	1DS_1908596 Best IWGSC match 167 4e-39 URGI_Best IWGSC_N
BLAST, e-value	4e-39 1DS_1908596 Best IWGSC match
DNA	catttaaagatggagtgccagggccctacttRtggaaatcatacaaggag gtctatgaggaagtcctgcaaattggatctgcgctgcagcagctcggggt gcaaccaggttccagggttg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.