Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV7704

[Submit comment/correction]

Sequence	IAAV7704
Contig	1BS_3447578
Probe	IAAV7704
DNA Homology	1BS_3447578 Best IWGSC match 281 0 URGI_Best IWGSC_N
BLAST, e-value	0 1BS_3447578 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccg tcgtgttcgacgccaaggaggcggcagatcgacctgccaagcgctgagtc Ratcgaggagctgcggaccccggactacgacgagctcctcaggtcgtttc acgagtcgagggctgggtggaagcaggcgaacggagacatgaaacacctc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.