Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA003412-0312

[Submit comment/correction]

Sequence	TA003412-0312
Contig	1BS_3471490
Probe	TA003412-0312
DNA Homology	1BS_3471490 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 1BS_3471490 Best IWGSC match
DNA	agtaccgcttgattcttgtcgaggtctgggtccgtcgatgtgtcagtccc Rcca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.