Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AS_3283228

[Submit comment/correction]

Sequence	RAC875_c11276_340
Contig	1AS_3283228
Probe	RAC875_c11276_340
DNA Homology	1AS_3283228 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 1AS_3283228 Best IWGSC match
DNA	acctccataacaagtgcctctgcggcgcgccgctcaccgcctgccgccag Mggcccgtcggctacctccattagagcgtcctccatccatcggttcaatc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.