Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AL_3976813

[Submit comment/correction]

Sequence	IACX6022
Contig	1AL_3976813
Probe	IACX6022
DNA Homology	1AL_3976813 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 1AL_3976813 Best IWGSC match
DNA	atcgccctgtctagacgcgcttggtttcttgttgatgatgtgccttccta accgcgactcRgaacctatatcaccagaagtaacggtcactt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.