Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c12932_2102

[Submit comment/correction]

Sequence	Excalibur_c12932_2102
Contig	1AL_3976804
Probe	Excalibur_c12932_2102
DNA Homology	1AL_3976804 Best IWGSC match 139 7e-31 URGI_Best IWGSC_N
BLAST, e-value	7e-31 1AL_3976804 Best IWGSC match
DNA	gcgatcagaacacctcccatggatctggtgagaagctctgatttttctgc Rtcccactgcaggacgcagaacttgtacctctccgtggcgatgaagagga a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.