Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV2844

[Submit comment/correction]

Sequence	IAAV2844
Contig	1AL_1498144
Probe	IAAV2844
DNA Homology	1AL_1498144 Best IWGSC match 196 0 URGI_Best IWGSC_N
BLAST, e-value	0 1AL_1498144 Best IWGSC match
DNA	cgaggaagttgccacgctcgtagaagaactctgccttctccaccttcgtg tcctcgtcaacatggaagacacagacgccgaagaactcgacRcggcggcc gtgcggagggtggcccttgaacgggccctccatgtagccccagtgccgga acttgaaggcgatcctggga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.