GrainGenes Sequence Report: 1AL_3937698
Sequence
RAC875_rep_c100394_536
Contig
1AL_3937698
Probe
RAC875_rep_c100394_536
DNA Homology
1AL_3937698 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value
2.94273e-44 1AL_3937698 Best IWGSC match
DNA
ctgcccatcgccctcgccttgcttgcacggttgccaccctcgccagtcac
Rcgtgcccggaccaccctcactgccgcccggtcctgcccaactcggtcat
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3937698
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
