Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c16136_129

[Submit comment/correction]

Sequence	RAC875_c16136_129
Contig	1AL_3879382
Probe	RAC875_c16136_129
DNA Homology	1AL_3879382 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 1AL_3879382 Best IWGSC match
DNA	ctattgcaagcctatagaaggcttccaccaaatgggttggcttgctgttg Mgagttatttgccgccgggaacgcgccgaagccactatccaggaatgggt t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.