GrainGenes Sequence Report: 1AL_3976729
Sequence
wsnp_Ku_c3804_6986527
Contig
1AL_3976729
Probe
wsnp_Ku_c3804_6986527
DNA Homology
1AL_3976729 Best IWGSC match 268 0 URGI_Best IWGSC_N
BLAST, e-value
0 1AL_3976729 Best IWGSC match
DNA
ggctttgatatttctttgacctccttagactttcccatcgttgaccagtt
cctgtgagatttgaccacacgacaatgtcagcaattgataggccataacc
Raccaaaaaggttcgagttgccaagtatccatcaagaaatgagcamgcrg
cttcaaattcagagcctgagagaatgagtggtgcgtactcgagccattgg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3976729
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
