Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig2963_429

[Submit comment/correction]

Sequence	RFL_Contig2963_429
Contig	1AL_3876661
Probe	RFL_Contig2963_429
DNA Homology	1AL_3876661 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 1AL_3876661 Best IWGSC match
DNA	tggtaggtgtgctgcagcttatcaaggacctttctgccgatgcccttgct Rtcgactggcgtatcatcctcatacttgagattaacatagtagtggttga a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.