Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c978_313

[Submit comment/correction]

Sequence	Kukri_c978_313
Contig	1AL_3941328
Probe	Kukri_c978_313
DNA Homology	1AL_3941328 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 1AL_3941328 Best IWGSC match
DNA	tcaagctcccggttcttggcgaaggtctcagggtcagccgagagaccggc Rgtgtcccacccatagtcaccggggaactcaccagtcaagtagttggggg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.