Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_BE444359A_Ta_2_1

[Submit comment/correction]

Sequence
wsnp_BE444359A_Ta_2_1
Contig
1AL_3953856
Probe
wsnp_BE444359A_Ta_2_1
DNA Homology
1AL_3953856Best IWGSC match1766.00036e-42URGI_BestIWGSC_N
BLAST, e-value
6.00036e-421AL_3953856Best IWGSC match
DNA
gggttgccagaacagaaggcacttgagcatagtgaaacacagccctgggc
agtgggcacaMaatagaccgccaatgcgagggaattcgtgtggcttgctt
acctacatgggaaggcaggac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.