GrainGenes Sequence Report: 1AL_3953856
Sequence
wsnp_BE444359A_Ta_2_1
Contig
1AL_3953856
Probe
wsnp_BE444359A_Ta_2_1
DNA Homology
1AL_3953856 Best IWGSC match 176 6.00036e-42 URGI_Best IWGSC_N
BLAST, e-value
6.00036e-42 1AL_3953856 Best IWGSC match
DNA
gggttgccagaacagaaggcacttgagcatagtgaaacacagccctgggc
agtgggcacaMaatagaccgccaatgcgagggaattcgtgtggcttgctt
acctacatgggaaggcaggac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3953856
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
