Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA005289-1104

[Submit comment/correction]

Sequence	TA005289-1104
Contig	1AL_827928
Probe	TA005289-1104
DNA Homology	1AL_827928 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 1AL_827928 Best IWGSC match
DNA	ggaagtgaatagtttatgcaagaggcaggcagggtgagggaggtgtgact Racc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.