Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX5960

[Submit comment/correction]

Sequence	IACX5960
Contig	1AL_2005105
Probe	IACX5960
DNA Homology	1AL_2005105 Best IWGSC match 198 0 URGI_Best IWGSC_N
BLAST, e-value	0 1AL_2005105 Best IWGSC match
DNA	atcaggttcaccgccagcttccggaggtcggagttcagctggccggggaa cctcaggcaRcaggtcactccgctcatggtggcagagatcagatggttca aatctccaaagctgggagtg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.