GrainGenes Sequence Report: wsnp_Ex_rep_c70358_69302556
Sequence
wsnp_Ex_rep_c70358_69302556
Contig
1AL_994841
Probe
wsnp_Ex_rep_c70358_69302556
DNA Homology
1AL_994841 Best IWGSC match 161 3e-37 URGI_Best IWGSC_N
BLAST, e-value
3e-37 1AL_994841 Best IWGSC match
DNA
tgatgatttgatttgagcaacaagcttattactccctcttggaatgacaa
gatcaatgacatcatcatgcttcagcaaatccgcaatttcatctctagtt
Rtaataaggccaatcaatttttcaccaacattgtcaggaatagcattggt
tataaccttatgcaatattgcgtttgatctcattgcttcttttccacctt
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: wsnp_Ex_rep_c70358_69302556
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
