Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c25507_551

[Submit comment/correction]

Sequence	RAC875_c25507_551
Contig	1AL_3975988
Probe	RAC875_c25507_551
DNA Homology	1AL_3975988 Best IWGSC match 119 9e-25 URGI_Best IWGSC_N
BLAST, e-value	9e-25 1AL_3975988 Best IWGSC match
DNA	aggacattgcccctaaatacgctggatccctacacggaatgacgaacggc Rttgggacagtggccgccatagttagcacagtaggagcaggatacttcgt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.