GrainGenes Sequence Report: wsnp_Ex_c4310_7770452
Sequence
wsnp_Ex_c4310_7770452
Contig
1AL_3959638
Probe
wsnp_Ex_c4310_7770452
DNA Homology
1AL_3959638 Best IWGSC match 246 0 URGI_Best IWGSC_N
BLAST, e-value
0 1AL_3959638 Best IWGSC match
DNA
ccgaggtagagggttttggcactatcaaggactctgagaccctctgcatg
ttcctgctagagaaagcacaggtcgcgcttgtccctggagatgcatttgg
Rgatgacaagggcattcgtatctcctacgctgctgcactgtcaacgctac
aatctgcgatggagaagataaaagacgcaatggctctgctcaaggcccct
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: wsnp_Ex_c4310_7770452
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
