GrainGenes Sequence Report: 1AL_3928613
Sequence
wsnp_Ex_rep_c66846_65240088
Contig
1AL_3928613
Probe
wsnp_Ex_rep_c66846_65240088
DNA Homology
1AL_3928613 Best IWGSC match 274 0 URGI_Best IWGSC_N
BLAST, e-value
0 1AL_3928613 Best IWGSC match
DNA
agatttccagcagcatctgtcagatggcggcggtgttatcaacgaatgtg
ggcagggctcatggttgcgcactccggtggcctggccttagtgccttagc
Raagaagttgcggagctcagggatgacgcgctggattagctgagagaaac
cgggtctggtgcagatcttatcaaactgctccaaaataaacaagacgcat
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3928613
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
