GrainGenes Sequence Report: 1AL_3943448
Sequence
wsnp_Ex_c34821_43076533
Contig
1AL_3943448
Probe
wsnp_Ex_c34821_43076533
DNA Homology
1AL_3943448 Best IWGSC match 250 0 URGI_Best IWGSC_N
BLAST, e-value
0 1AL_3943448 Best IWGSC match
DNA
tgtacttgatggtggatgtgctttcgaacaagctataatggaaagaggac
gagggaattctttatttaacttcttgtttgatcttaaatcgcaagagcac
Rcatactatgtctggcggttatactcctttgctcagggcgatactttaca
acgatggcgaaccgaaccatttatcatgattactggaagtgcaagatggg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3943448
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
