GrainGenes Sequence Report: wsnp_Ex_c9979_16421462
Sequence
wsnp_Ex_c9979_16421462
Contig
1AL_3952934
Probe
wsnp_Ex_c9979_16421462
DNA Homology
1AL_3952934 Best IWGSC match 368 0 URGI_Best IWGSC_N
BLAST, e-value
0 1AL_3952934 Best IWGSC match
DNA
attgcgtgtagcagcaacacacagattgcaatagatgaaactcaggaacc
cctggcgcaaacttacggtgtggtggctatcccgttgcacagagcaaaag
Rctccgaagcattcacatcaaaagactattctcaaaaaatatgcaaagtg
gattgcatgtcaccgtatggtttcagggtagaaccatctcaaaaatgaat
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: wsnp_Ex_c9979_16421462
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
