Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX2325

[Submit comment/correction]

Sequence	IACX2325
Contig	1AL_3978389
Probe	IACX2325
DNA Homology	1AL_3978389 Best IWGSC match 219 0 URGI_Best IWGSC_N
BLAST, e-value	0 1AL_3978389 Best IWGSC match
DNA	atctcatcaatacatggcaccaacagtcggaaccagggttggagacacgc cgcctttgaScctaaggccgagcgggtcccagagctggacagcacctgag ctcccagttttcaggctcac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.