GrainGenes Sequence Report: tplb0041a22_935
Sequence
tplb0041a22_935
Contig
1AL_3974768
Probe
tplb0041a22_935
DNA Homology
1AL_3974768 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value
2.94273e-44 1AL_3974768 Best IWGSC match
DNA
agggctcgatcaccatgacgccggagttgaagagagtcgcgttgttgccc
Rtcgcggtgatctctggcatcgcgaacaggaagtccacgttcctcaggat
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: tplb0041a22_935
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
