Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AL_3974768

[Submit comment/correction]

Sequence	tplb0041a22_935
Contig	1AL_3974768
Probe	tplb0041a22_935
DNA Homology	1AL_3974768 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 1AL_3974768 Best IWGSC match
DNA	agggctcgatcaccatgacgccggagttgaagagagtcgcgttgttgccc Rtcgcggtgatctctggcatcgcgaacaggaagtccacgttcctcaggat g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.