Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AL_3936310

[Submit comment/correction]

Sequence	Ku_c6979_182
Contig	1AL_3936310
Probe	Ku_c6979_182
DNA Homology	1AL_3936310 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 1AL_3936310 Best IWGSC match
DNA	agtgtccatgaatgagctggatgacatgactctgagaaaggaataccccc Mggaagctctcgaggagacgtgttacttcagtgactacgaccatggtgtt a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.