Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AL_3948465

[Submit comment/correction]

Sequence	IACX7695
Contig	1AL_3948465
Probe	IACX7695
DNA Homology	1AL_3948465 Best IWGSC match 324 0 URGI_Best IWGSC_N
BLAST, e-value	0 1AL_3948465 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnntgtaatatttccttctttgctgcaac tgcaaagagggatcactgatatggaggacaagaagcagaaggccgtgtgt Mtggagaggtacagaaggagagatgaagacgaaacaagcagcttatctga tgttgatgctgagagggaggaggaatgtgggatctgcatggagatgaaca g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.