GrainGenes Sequence Report: 1AS_1471577
Sequence
wsnp_Ex_c66106_64268316
Contig
1AS_1471577
Probe
wsnp_Ex_c66106_64268316
DNA Homology
1AS_1471577 Best IWGSC match 368 0 URGI_Best IWGSC_N
BLAST, e-value
0 1AS_1471577 Best IWGSC match
DNA
tcggttttctggagattaaacatattgatgcatccagcaacctccttacc
agaacaaatttcaacctgcattggttcagggagactagagcagtttgacc
Rtgtgttactgaaaatttctcctcgggcccaaccggagttgcaggttgtc
caaaacacgggcaacattcacaagccgtggatcgtccgaaggaatttctc
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AS_1471577
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
