GrainGenes Sequence Report: wsnp_Ex_c645_1273901
Sequence
wsnp_Ex_c645_1273901
Contig
1AL_3977019
Probe
wsnp_Ex_c645_1273901
DNA Homology
1AL_3977019 Best IWGSC match 368 0 URGI_Best IWGSC_N
BLAST, e-value
0 1AL_3977019 Best IWGSC match
DNA
gcttggtgcttctgttgaaggtctctgctctcgtcgagggatctgcagcg
ctgctcgatgccagaggaaggctcaggaggggagctagacacatcggtgt
Mtccaggtttgcaatcgctctgtccatctgcgttgccgttttctgggtca
tctgttccagtgtccagctgaatcacttcctccatccgagacacaggatc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: wsnp_Ex_c645_1273901
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
