Query (optional)   in Class  

GrainGenes Sequence Report: 1AL_3947020

[Submit comment/correction]

Sequence
wsnp_Ex_c6278_10941843
Contig
1AL_3947020
Probe
wsnp_Ex_c6278_10941843
DNA Homology
1AL_3947020Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
01AL_3947020Best IWGSC match
DNA
tcgagtgatctgcctagttcctaatcaatgttttccctgcaccatgctat
ctacaattattatgtgatgcaggtgacaaccaatttacatgtgtagtccc
Ratatccctcaaataactgtgcgttacatcccaaattgcaaggaagccat
atatatatatacgtgcaaatttacggtataatgaggcttgcacatgcata
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.