Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX9106

[Submit comment/correction]

Sequence	IACX9106
Contig	1AL_3918193
Probe	IACX9106
DNA Homology	1AL_3918193 Best IWGSC match 279 0 URGI_Best IWGSC_N
BLAST, e-value	0 1AL_3918193 Best IWGSC match
DNA	gaggaccggacctaagggacaagatcaattataaacgtgacagggatcaa aggaactacagagatgagaggagggacagggggcagcatggaaataacaa Saacaacaacaactcttttcagaagattgacaagaggaactacaagtgcc ata

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.