Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AS_3267990

[Submit comment/correction]

Sequence	Ex_c29914_480
Contig	1AS_3267990
Probe	Ex_c29914_480
DNA Homology	1AS_3267990 Best IWGSC match 122 7e-26 URGI_Best IWGSC_N
BLAST, e-value	7e-26 1AS_3267990 Best IWGSC match
DNA	catcccctgaacgtgccatggatgccacatggatgcaggaacttaacata Magcggccacctacaccaactagaggacggccgcattctgctggtgacag g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.