Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig1027_442

[Submit comment/correction]

Sequence	RFL_Contig1027_442
Contig	1AS_3289602
Probe	RFL_Contig1027_442
DNA Homology	1AS_3289602 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 1AS_3289602 Best IWGSC match
DNA	aaggaggaggaagatgaaatgtacgtgttctcgacgagccagaagcgcgt Rtcggtggaattggtcgggacgaacaaggtccgggacaagctgaagaact t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.