GrainGenes Sequence Report: BS00026003_51
Sequence
BS00026003_51
Contig
1AS_1195354
Probe
BS00026003_51
DNA Homology
1AS_1195354 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value
2.94273e-44 1AS_1195354 Best IWGSC match
DNA
aggaagtgatttgatagaactgtttgagagatcaaggtacctcagatgat
Rcagatacattgatttcagaagaaatgattctgtgcctctaatacagagc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: BS00026003_51
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
