GrainGenes Sequence Report: [Scl1155ct1506cn1679]
Sequence
[Scl1155ct1506cn1679]
Probe
[Scl1155ct1506cn1679]
DNA
tagcctcaacgcctccgcccccccactcgcgagaccctagctagccctag
cgccacccgccgactcacccggagagaggaggaggaggaggaggccttcg
ccgtggtcgtcggccgcgaggagcaggcgccaggatgttcgggtaccaga
agggcgtcgacgtcgctgcggggacctccgccgccacgggcggcggcgcg
cgccagctctacccggggatgcaggagagccccgagctgcgctgggcgct
catccgcaagatctacgtcatcctctccctccagctgctcctcaccgccg
tcgtcgccgccgtcgtcgtcaaggtccgcgccatcccgcacttcttcacc
accaccaacgccgggctcggactctacatcttcctcatcatcctcccctt
catcgtgctgtgcccgttgtacttctaccatgagaagcacccagtcaacc
tgatcctgctcggcctcttcaccgtcgccatcagcttctctgtgggcttg
acatgtgccttcaccagtggcaaggtcattctggaatctgcaattctgac
aacagtgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [Scl1155ct1506cn1679]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
