GrainGenes Sequence Report: [Scl1004ct1349cn1515]
Sequence
[Scl1004ct1349cn1515]
Probe
[Scl1004ct1349cn1515]
DNA
ccgagcccatcacgctggccgagtactcgctcgccggaaccggcggcgac
cagttcgacatctccctcgtccacggcttcaacgcgcccatgtcgttcct
ccccagcggcggcggcggcggcgccagcaggtgcgccaggggagcagggc
cgtcgtgcccggtgcaggagatcacgttcgactgcccctccgagcagcgg
cgggtggccgggtgcggcaacccgtgcgacggccagagcagcagctgcgg
ccccaacaacgggacggagtacttcaagaaggcgtgcccgcagacggtca
cgtaccccagggacaccagcaacaccatctttacgtgcccggccgggacg
agctacgagatcaccttctgcccgtgaaaaatgacgagcttgcgatctga
aagtttcatgtttgcgtgtagtacgtacaaacataagttatatatatcta
gatgataaataaaaaggtggccagatgtgtgctgtgtttacatatagtgt
gatgtatagttgtatacttattaaacatatgtactactgtacgtattgtg
tagccggtaaacacgtgagtaat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [Scl1004ct1349cn1515]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
